Methods

Metabarcoding analysis

DNA from all samples were extracted using the Qiagen DNEasy Power Soil kit. Amplification of 18S, CO1-F230 and, ITS sequences were performed at the Great Lakes Forestry Centre, Sault Ste. Marie using the primer sets in (Table S1). Triplicate PCR reactions were performed on each sample using primers using HotStarTaq Plus with illumina adaptor sequences, pooled, purified and quantified using the QiaCube fluorometric quantification. PCR reaction conditions are listed in Table S2. Metabarcoding was performed on the Illumina MiSeq platform at the Centre for Biodiversity Genomics, University of Guelph for 18S, CO1-F230 and, ITS amplicons. Amplification of amplicons and Metabarcoding were performed at Metagenombio for 16S amplicons from submitted environmental DNA.

Table S1: Base primers used for sequence amplification.
target forward reverse
d16S 16S v4-v5 5’-CCTACGGGNBGCASCAG1 5’-GACTACNVGGGTATCTAATCC1
d18S 18S v4 5’- CCAGCASCYGCGGTAATTCC2 5’- ACTTTCGTTCTTGATYRA2
CO1F230 CO1 - F230 5’- GGTCAACAAATCATAAAGATATTGG3 5’- CTTATRTTRTTTATICGIGGRAAIGC4
ITS2 ITS2 5’- GAACGCAGCRAAIIGYGA5 5’- TCCTCCGCTTATTGATATGC6

In addition to the main primer sequence, primers used for amplification of 18S, ITS, and COI sequences had an illumina p5 adapter (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’) fused to the 5’ end of the forward primer, and another illumina p7 adapter (5’ -GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-primer-3’) fused to the 5’ end of the reverse primer.

Table S2: PCR conditions used for sequence amplifications performed at the Great Lakes Forestry Centre, Sault Ste. Marie.
target PCR conditions
d18S 18S v4 95°C for 5 min, 5 cycles (94°C for 45 s, 54°C for 45 s, 72°C for 45 s), 25 cycles (94°C for 45 s, 47°C for 45 s, 72°C for 45 s), 72°C for 10 min
CO1F230 CO1 - F230 95°C for 5 min, 30 cycles (94°C for 45 s, 43°C for 45 s, 72°C for 45 s), 72°C for 10 min
ITS2 ITS2 95°C for 5 min, 30 cycles (94°C for 45 s, 53°C for 45 s, 72°C for 45 s), 72°C for 10 min
Table S3: Summary statistics from read merging and primer trimming via the MetaWorks v1.4.0 pipeline
Step Total seq number (across samples) Mean seq number (per sample) min seq length max seq length mean seq length amplicon
R1 8028118 46948.06 251.00000 251.0000 251.0000 16S
R2 8028118 46948.06 251.00000 251.0000 251.0000 16S
paired 5898010 34491.29 79.57895 455.9942 411.7317 16S
Ftrimmed 5781281 33808.66 314.18713 436.1988 392.7466 16S
Rtrimmed 5776828 33782.62 319.52047 416.0526 372.8795 16S
R1 85517092 186718.54 35.55895 301.0000 295.9288 18S
R2 85517092 186718.54 35.53275 301.0000 296.1581 18S
paired 76288757 166569.34 36.15502 486.7183 355.7121 18S
Ftrimmed 19706028 43026.26 173.80568 466.3253 398.7665 18S
Rtrimmed 19571897 42733.40 179.22926 448.3777 380.9189 18S
R1 85517092 186718.54 35.55895 301.0000 295.9288 F230
R2 85517092 186718.54 35.53275 301.0000 296.1581 F230
paired 76288757 166569.34 36.15502 486.7183 355.7121 F230
Ftrimmed 17889517 39060.08 184.94541 374.3799 258.3421 F230
Rtrimmed 17856519 38988.03 181.49345 342.3668 232.4368 F230
R1 85517092 186718.54 35.55895 301.0000 295.9288 ITS
R2 85517092 186718.54 35.53275 301.0000 296.1581 ITS
paired 76288757 166569.34 36.15502 486.7183 355.7121 ITS
Ftrimmed 25350300 55350.00 216.76856 466.3712 345.0956 ITS
Rtrimmed 25285054 55207.54 207.23144 446.3712 325.1651 ITS
Table S4: Summary statistics from dereplication and chimera filtering via the MetaWorksv1.4.0 pipeline
Step number min max mean amplicon
dereplication 2984905 167 438 373 16S
chimera removal 16S/cat.denoised: 22917/75358 chimeras (30.4%) 339 425 373 16S
dereplication 8296788 150 458 381 18S
chimera removal 18S/cat.denoised: 11306/42971 chimeras (26.3%) 150 449 380 18S
dereplication 3172677 150 436 232 F230
chimera removal F230/cat.denoised: 2900/35935 chimeras (8.1%) 150 430 233 F230
dereplication 8955577 150 454 325 ITS
chimera removal ITS/cat.denoised: 5852/34438 chimeras (17.0%) 152 450 320 ITS

The rarecurve function in vegan was used to visually examine samples for sufficient read depths (whether the number of ASVs reached a plateau) before it was decided that data analysis could proceed without rarefying7.

Table S5: Percentage of ASV classified to Genus or assigned to a functional attribute for each metabarcoding target.
Target Number of ASV Percent of ASV identified to Genus Percent of ASV assigned to a functional attribute
ITS 22083 49.50414 64.03744
16S 27539 65.68140 48.78898
F230 7923 100.00000 39.24602
18S 22166 23.18867 NA

Statistical testing

Table S6: Summary of statistical tests run in this paper.
Response variable Test Explanatory variables Random variables Data subsets
Enzyme activity Mixed-effects ANOVA ash addition, ash addition amount site, soil type Full datasets for NAG and PHOS activities
Enzyme activity Fixed-effects ANOVA ash addition, ash addition amount, site, soil type with interaction None Full datasets for PHOS and NAG activities
Enzyme activity lm applied calcium kg ha-1, applied phosphorus kg ha-1, and, applied sodium kg ha-1, Stand age, dominant tree species, precipitaion of wettest quarter, precipitation of seasonality None Full datasets for PHOS and NAG activities
Difference in enzyme activity between controls and treatment for each block One-way Wilcoxon test None None Each site, ash type and amendment rate evaluated individually for NAG and PHOS
One model for each diversity metric (Shannon, Inverse Simpsons, Richness) Mixed-effects ANOVA ash addition, ash addition amount site, soil type Full dataset
Difference between controls and treatment for each block model for each diversity metric (Shannon, Inverse Simpsons, Richness) One-way Wilcoxon test None None Each site, ash type and amendment rate evaluated individually
Compositional variance of each metabarcoding target and summarization level PCA None None Full dataset
Compositional variance of each metabarcoding target and summarization level Partial RDA applied calcium kg ha-1, applied phosphorus kg ha-1, and, applied sodium kg ha-1 Site, soil type
Compositional variance of each group for each metabarcoding target and summarization level Aldex glm applied calcium kg ha-1, applied phosphorus kg ha-1, and, applied sodium kg ha-1, Stand age, dominant tree species, precipitaion of wettest quarter, precipitation of seasonality None Soil type
Difference between control and treatment compositional variance of each group for each metabarcoding target and summarization level Aldex pairwise analysis None None Each site, ash type and amendment rate evaluated individually

Results

Enzyme Analyses

Community Analyses

Alpha Diversity

Table S11: Type III Analysis of variance results for diversity metrics for each metabarcoding target as explained by ash amendment (Ash) and amount of ash amendment (ash_amt) after accounting for effects of site and soil horizon (soil type).
Amplicon Diversity metric Parameter Chisq Degrees of Freedom Pr(>Chisq)
ITS Shannon (Intercept) 1,359.926 1 0.000
ITS Shannon Ash 0.015 1 0.901
ITS Shannon ash_amt 0.971 1 0.324
ITS InverseSimpson (Intercept) 57.045 1 0.000
ITS InverseSimpson Ash 0.191 1 0.662
ITS InverseSimpson ash_amt 1.473 1 0.225
ITS richness (Intercept) 57.045 1 0.000
ITS richness Ash 0.191 1 0.662
ITS richness ash_amt 1.473 1 0.225
16S Shannon (Intercept) 1,786.247 1 0.000
16S Shannon Ash 1.434 1 0.231
16S Shannon ash_amt 0.499 1 0.480
16S InverseSimpson (Intercept) 32.931 1 0.000
16S InverseSimpson Ash 0.337 1 0.561
16S InverseSimpson ash_amt 2.742 1 0.098
16S richness (Intercept) 125.379 1 0.000
16S richness Ash 0.035 1 0.852
16S richness ash_amt 0.000 1 0.989
F230 Shannon (Intercept) 195.349 1 0.000
F230 Shannon Ash 0.891 1 0.345
F230 Shannon ash_amt 1.583 1 0.208
F230 InverseSimpson (Intercept) 15.204 1 0.000
F230 InverseSimpson Ash 0.101 1 0.751
F230 InverseSimpson ash_amt 0.010 1 0.920
F230 richness (Intercept) 15.204 1 0.000
F230 richness Ash 0.101 1 0.751
F230 richness ash_amt 0.010 1 0.920
18S Shannon (Intercept) 1,509.821 1 0.000
18S Shannon Ash 1.329 1 0.249
18S Shannon ash_amt 0.617 1 0.432
18S InverseSimpson (Intercept) 62.995 1 0.000
18S InverseSimpson Ash 1.008 1 0.315
18S InverseSimpson ash_amt 0.733 1 0.392
18S richness (Intercept) 62.995 1 0.000
18S richness Ash 1.008 1 0.315
18S richness ash_amt 0.733 1 0.392
 Scaled differences in alpha diversity metrics between treatments and controls of blocks within each site.

Figure S1: Scaled differences in alpha diversity metrics between treatments and controls of blocks within each site.

Table S12: Table 1. Distribution of the alpha diversity pairwise wilcoxon test results for site and treatment combinations with at least one significant result. Tests for ASV, genus and functional groups are represented by A, G and F respectively and bolded where the result was significant at a Bonferonni corrected \(\alpha\) of 0.05. 92 of 1494 tests are displayed in this table with only 28 significant results (~2%).
Site Soil Type diversity_metric Mg/ha Ash Type of Ash 18S F230 ITS 16S
HLB 0-10 cm mineral soil InverseSimpson 4.0 Bottom A G A F G A F G NA
HLB 0-10 cm mineral soil richness 4.0 Bottom A G A F G A F G NA
HLB 0-10 cm mineral soil Shannon 4.0 Bottom A G A F G A F G NA
ILK 0-10 cm mineral soil InverseSimpson 0.7 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil InverseSimpson 2.8 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil InverseSimpson 5.6 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil richness 0.7 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil richness 2.8 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil richness 5.6 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil Shannon 0.7 Bottom A G A F G A F G A F G
ILK 0-10 cm mineral soil Shannon 2.8 Bottom A G A F G A F G A F G
HLB FH-layer forest floor InverseSimpson 4.0 Bottom A G A F G A F G NA
HLB FH-layer forest floor richness 4.0 Bottom A G A F G A F G NA
HLB FH-layer forest floor Shannon 4.0 Bottom A G A F G A F G NA
HLB FH-layer forest floor Shannon 8.0 Fly A G A F G A F G A F G
ETM surface litter &/or moss InverseSimpson 20.0 Bottom A G A F G A F G NA
ETM surface litter &/or moss richness 20.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss InverseSimpson 1.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss InverseSimpson 4.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss InverseSimpson 4.0 Fly A G A F G A F G A F G
HLB surface litter &/or moss InverseSimpson 8.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss richness 1.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss richness 4.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss richness 4.0 Fly A G A F G A F G A F G
HLB surface litter &/or moss richness 8.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss Shannon 1.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss Shannon 4.0 Bottom A G A F G A F G NA
HLB surface litter &/or moss Shannon 4.0 Fly A G A F G A F G A F G
HLB surface litter &/or moss Shannon 8.0 Bottom A G A F G A F G NA

Island Lake was the only site where the distances between ash-treatment and controls were larger than the differences between control replicates within plots. Though there were higher distances at Genus and Functional levels as well, only ASV is used is discussion due to the interpretation issues that are introduced from incomplete Genus and functional assignments.

 Scaled difference in ASV community distance (Jaccard for Presence-Absence or Bray-Curtis for rarefied data) between Ash Addition plots compared to controls to distance between controls for each block. Only Island Lake is shown, as no other sites had any distances that were significantly higher than controls at $\alpha$ = 0.05.

Figure S2: Scaled difference in ASV community distance (Jaccard for Presence-Absence or Bray-Curtis for rarefied data) between Ash Addition plots compared to controls to distance between controls for each block. Only Island Lake is shown, as no other sites had any distances that were significantly higher than controls at \(\alpha\) = 0.05.

CODA PCA

Compositional variance explained in first two PC axes for each metabarcoding dataset.

Figure S3: Compositional variance explained in first two PC axes for each metabarcoding dataset.

CODA RDA

RDA of ITS ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

Figure S4: RDA of ITS ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

RDA of 16S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

Figure S5: RDA of 16S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

RDA of F230 ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

Figure S6: RDA of F230 ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

RDA of 18S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

Figure S7: RDA of 18S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions

Modeling of distinct species

## Warning: Vectorized input to `element_text()` is not officially supported.
## Results may be unexpected or may change in future versions of ggplot2.
Benjamini-Hochberg corrected p-values from aldex-glms performed on ASV, Genus level and functional tables from 16S, 18S, ITS and F230 datasets. $\alpha$ = 0.05 is shown as a lightly coloured dashed line. Parameters associated with ash quality are bolded.

Figure S8: Benjamini-Hochberg corrected p-values from aldex-glms performed on ASV, Genus level and functional tables from 16S, 18S, ITS and F230 datasets. \(\alpha\) = 0.05 is shown as a lightly coloured dashed line. Parameters associated with ash quality are bolded.

Ash phosphorus addition was a significantly associated with changes in the compositonal amount of some arthropod ASVs. There were no additional significant associations of ash related paramenters to the centered log-ratio values for any targeted group after Benjamini-Hochberg correction was performed.

When assessed via pairwise comparisons using compositional t-tests, controls and treatments did not have any ASVs, genus or functional groups that were identified as significantly different (\(\alpha\) = 0.05).

## Warning: Vectorized input to `element_text()` is not officially supported.
## Results may be unexpected or may change in future versions of ggplot2.
Benjamini-Hochberg corrected p-values from glms on the gain or loss of a target group as compared to a control site. Glms were performed on ASV, Genus level and functional tables from 16S, 18S, ITS and F230 datasets. $\alpha$ = 0.05 is shown as a lightly coloured dashed line. Parameters associated with ash quality are bolded.

Figure S9: Benjamini-Hochberg corrected p-values from glms on the gain or loss of a target group as compared to a control site. Glms were performed on ASV, Genus level and functional tables from 16S, 18S, ITS and F230 datasets. \(\alpha\) = 0.05 is shown as a lightly coloured dashed line. Parameters associated with ash quality are bolded.

Proportion of sites with changes in gain/loss of a target group significantly (B-H p <= 0.05) associated with an ash-amendment related parameter.

Figure S10: Proportion of sites with changes in gain/loss of a target group significantly (B-H p <= 0.05) associated with an ash-amendment related parameter.

Upon visual inspection of the percentage of sites that had a gain or loss, patterns in ASV or genus that were found to be significantly associated to estimated total phosphorus or total calcium in the applied ash were site dependent, or showed conflicting patterns in different sites (e.g., Losses of Uroleptus in SRD and Gains at ALN, ALS sites)

Traditional diversity analysis

We also ran some more traditional NMDS and beta-diversity analyses using the vegan package in R, which found a lack of consistent influence of ash additions on community composition. Bacterial (16S) datasets were assessed as relative abundance using Bray-Curtis distance, and all other datasets were assessed as presence/absence matrixes using Jaccard distances..

Community assemblages were visually different for some sites at the ASV level. These differences were not consistently present when datasets were summarized at genus or functional levels, which can be at least partially attributed to the loss of ASVs that could not be identified at these levels (Supplemental Results: Figures S12 - S22).

Ordination of ITS ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S11: Ordination of ITS ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of ITS functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S12: Ordination of ITS functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of ITS Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S13: Ordination of ITS Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of 16S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S14: Ordination of 16S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of 16S functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S15: Ordination of 16S functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of 16S Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S16: Ordination of 16S Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

 Ordination of F230 ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S17: Ordination of F230 ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of F230 functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S18: Ordination of F230 functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of F230 Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S19: Ordination of F230 Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of Eukaryote ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S20: Ordination of Eukaryote ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Ordination of Eukaryote Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Figure S21: Ordination of Eukaryote Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.

Table S13: Results of mixed effects adonis testing of different metabarcode targets. Ash and ash amount (ash_amt) as well as site and soil horizon (Soil_type) were included in the models.
Dataset Parameter Degrees of Freedom Sums of Squares MeanSqs F.Model R2 Pr(>F)
ITS_ASV Site 7 33.9741707 4.8534530 13.7167935 0.1668752 0.001
ITS_ASV Soil_type 3 13.2225858 4.4075286 12.4565253 0.0649470 0.001
ITS_ASV Ash 1 0.5289887 0.5289887 1.4950240 0.0025983 0.013
ITS_ASV ash_amt 1 0.5319151 0.5319151 1.5032945 0.0026127 0.020
ITS_ASV Residuals 439 155.3326473 0.3538329 NA 0.7629668 NA
ITS_ASV Total 451 203.5903076 NA NA 1.0000000 NA
ITS_functional Site 7 0.2233970 0.0319139 2.0801489 0.0313354 0.001
ITS_functional Soil_type 3 0.1335244 0.0445081 2.9010442 0.0187291 0.001
ITS_functional Ash 1 0.0259919 0.0259919 1.6941578 0.0036458 0.140
ITS_functional ash_amt 1 0.0111311 0.0111311 0.7255246 0.0015613 0.601
ITS_functional Residuals 439 6.7351830 0.0153421 NA 0.9447283 NA
ITS_functional Total 451 7.1292274 NA NA 1.0000000 NA
ITS_Genus Site 7 28.0613012 4.0087573 22.4071059 0.2279515 0.001
ITS_Genus Soil_type 3 15.9488643 5.3162881 29.7156004 0.1295581 0.001
ITS_Genus Ash 1 0.2728413 0.2728413 1.5250571 0.0022164 0.054
ITS_Genus ash_amt 1 0.2794783 0.2794783 1.5621548 0.0022703 0.058
ITS_Genus Residuals 439 78.5395699 0.1789056 NA 0.6380037 NA
ITS_Genus Total 451 123.1020550 NA NA 1.0000000 NA
16S_ASV Site 6 19.6980473 3.2830079 18.4602692 0.3334116 0.001
16S_ASV Soil_type 3 10.8294750 3.6098250 20.2979535 0.1833011 0.001
16S_ASV Ash 1 0.2119635 0.2119635 1.1918656 0.0035877 0.223
16S_ASV ash_amt 1 0.2417696 0.2417696 1.3594642 0.0040922 0.146
16S_ASV Residuals 158 28.0990077 0.1778418 NA 0.4756074 NA
16S_ASV Total 169 59.0802631 NA NA 1.0000000 NA
16S_functional Site 6 1.2469285 0.2078214 19.1035369 0.2609162 0.001
16S_functional Soil_type 3 1.7709942 0.5903314 54.2649451 0.3705755 0.001
16S_functional Ash 1 0.0081500 0.0081500 0.7491706 0.0017054 0.490
16S_functional ash_amt 1 0.0341322 0.0341322 3.1375322 0.0071421 0.021
16S_functional Residuals 158 1.7188327 0.0108787 NA 0.3596608 NA
16S_functional Total 169 4.7790375 NA NA 1.0000000 NA
16S_Genus Site 6 10.4732088 1.7455348 30.2063369 0.3863799 0.001
16S_Genus Soil_type 3 7.3481268 2.4493756 42.3862441 0.2710887 0.001
16S_Genus Ash 1 0.0751724 0.0751724 1.3008516 0.0027733 0.221
16S_Genus ash_amt 1 0.0791306 0.0791306 1.3693490 0.0029193 0.186
16S_Genus Residuals 158 9.1303523 0.0577870 NA 0.3368389 NA
16S_Genus Total 169 27.1059910 NA NA 1.0000000 NA
F230_ASV Site 7 20.7381843 2.9625978 7.1325441 0.1090650 0.001
F230_ASV Soil_type 3 6.7971089 2.2657030 5.4547487 0.0357469 0.001
F230_ASV Ash 1 0.5189532 0.5189532 1.2493955 0.0027292 0.028
F230_ASV ash_amt 1 0.5146315 0.5146315 1.2389911 0.0027065 0.013
F230_ASV Residuals 389 161.5763621 0.4153634 NA 0.8497523 NA
F230_ASV Total 401 190.1452401 NA NA 1.0000000 NA
F230_functional Site 7 6.4025259 0.9146466 7.0844409 0.0981975 0.001
F230_functional Soil_type 3 8.3954727 2.7984909 21.6758520 0.1287640 0.001
F230_functional Ash 1 0.0714515 0.0714515 0.5534309 0.0010959 0.708
F230_functional ash_amt 1 0.1086533 0.1086533 0.8415795 0.0016664 0.482
F230_functional Residuals 389 50.2223839 0.1291064 NA 0.7702762 NA
F230_functional Total 401 65.2004873 NA NA 1.0000000 NA
F230_Genus Site 7 20.3349198 2.9049885 9.1685638 0.1321508 0.001
F230_Genus Soil_type 3 9.5102304 3.1700768 10.0052207 0.0618043 0.001
F230_Genus Ash 1 0.3940371 0.3940371 1.2436380 0.0025607 0.104
F230_Genus ash_amt 1 0.3857501 0.3857501 1.2174830 0.0025069 0.121
F230_Genus Residuals 389 123.2516414 0.3168423 NA 0.8009773 NA
F230_Genus Total 401 153.8765787 NA NA 1.0000000 NA
18S_ASV Site 7 23.1246266 3.3035181 9.2482505 0.1178996 0.001
18S_ASV Soil_type 3 15.5969925 5.1989975 14.5546747 0.0795204 0.001
18S_ASV Ash 1 0.4903257 0.4903257 1.3726743 0.0024999 0.025
18S_ASV ash_amt 1 0.4706715 0.4706715 1.3176523 0.0023997 0.035
18S_ASV Residuals 438 156.4556366 0.3572046 NA 0.7976804 NA
18S_ASV Total 450 196.1382528 NA NA 1.0000000 NA
18S_Genus Site 7 14.1249361 2.0178480 13.9566615 0.1582337 0.001
18S_Genus Soil_type 3 11.4207355 3.8069118 26.3309125 0.1279401 0.001
18S_Genus Ash 1 0.2034405 0.2034405 1.4071177 0.0022790 0.076
18S_Genus ash_amt 1 0.1913415 0.1913415 1.3234342 0.0021435 0.112
18S_Genus Residuals 438 63.3258487 0.1445796 NA 0.7094037 NA
18S_Genus Total 450 89.2663024 NA NA 1.0000000 NA
 Significance of pairwise PERMANOVA test results for each soil layer, site and treatment combination as compared to controls. Values lower than 0.05 were spread amongst different taxonomic levels and targets. Lower p-values indicated that there was a low probability of the community from ash treatment being the same as controls from the same site. Colour and shape are used to differentiate the targeted sequence and grouping level used for each test.

Figure S22: Significance of pairwise PERMANOVA test results for each soil layer, site and treatment combination as compared to controls. Values lower than 0.05 were spread amongst different taxonomic levels and targets. Lower p-values indicated that there was a low probability of the community from ash treatment being the same as controls from the same site. Colour and shape are used to differentiate the targeted sequence and grouping level used for each test.

PERMANOVA tests of each metabarcode summarized at ASV, Genus and functional characteristics showed significant (p <0.05) influence of ash amendment or ash amount on community composition for ITS, F230 and 18S datasets. The majority of the variance was explained by site and soil horizon, and ash amendment explained a small proportion of the variance, with R2 values less than 0.003. Pairwise assessment of community distributions from block treatment-control pairings showed a small proportion of treatments that resulted in a shift from controls significant at \(\alpha\) = 0.05, only the ILK F230 ASV dataset FH layer was found to be significantly different between 2.8 t ha-1 wood ash amended soils and controls after using a Bonferroni-corrected alpha to account for the number of tests performed (Figure S22).

Table S14: Distribution of the adonis results. Tests for ASV, Genus and Functional groups are represented by A, G and F respectively and bolded where the result was significant at an \(\alpha\) of 0.05.
Site Soil Type Mg/ha Ash Type of Ash Arthropods (F230) Eukaryotic (18S) Fungal (ITS) Bacterial (16S)
HLB 0-10 cm mineral soil 4.0 Fly A F G A G A F G
HLB 0-10 cm mineral soil 8.0 Bottom A F G A G A F G
ILK 0-10 cm mineral soil 1.4 Bottom A F G A G A F G A F G
ILK 0-10 cm mineral soil 2.8 Bottom A F G A G A F G A F G
SRD 0-10 cm mineral soil 10.0 Fly A F G A G A F G A F G
HLB FH-layer forest floor 1.0 Fly A F G A G A F G A F G
HLB FH-layer forest floor 8.0 Bottom A F G A G A F G
ILK FH-layer forest floor 0.7 Bottom A F G A G A F G A F G
ILK FH-layer forest floor 1.4 Bottom A F G A G A F G A F G
ILK FH-layer forest floor 2.8 Bottom A F G A G A F G A F G
ILK FH-layer forest floor 5.6 Bottom A F G A G A F G A F G
PLD surface litter &/or moss with FH layer 1.5 Mixed A F G A G A F G A F G
SRD surface litter &/or moss with FH layer 1.0 Fly A F G A G A F G A F G

Potential differences detected in some sites occurred in both clearcut (ILK, PLD, SRD) and selection cut systems (HLB). Most of these differences were from the Island Lake site, for 18S and ITS data, indicating a fungal response. Significant (at \(\alpha\) = 0.05) PERMANOVA results did not coincide with significant differences in betadispersion, showing that these differences are likely due to a shift in average community composition, rather than a differences in community structure variance (Supplemental Results: Table S10, S11). The differences in betadispersion were mainly from the ASV level analyses of F230 (arthropod) datasets, and corresponded to NMDS analysis, suggesting that there is generally higher dispersion in the controls compared to individual treatments. The solid polygons representing treatment dispersals were generally smaller than the area encapsulated by the solid line (Supplementary Results: Figure S19, Figure S20). Only the ILK sites had shifts in community distance due to treatment that were significantly greater than distances between controls within blocks. However, these differences were comparable to the distances from between-block comparisons (Supplemental Results: Figure S2).

 Significance of pairwise betadispersion testing from metabarcoding subsets summarized at functional, genus and ASV levels. Significance at an $\alpha$ of 0.05 and the Bonferonni corrected $\alpha$ for each subset are shown on the graph as a light coloured dashed line, and dark coloured solid line, respectively.

Figure S23: Significance of pairwise betadispersion testing from metabarcoding subsets summarized at functional, genus and ASV levels. Significance at an \(\alpha\) of 0.05 and the Bonferonni corrected \(\alpha\) for each subset are shown on the graph as a light coloured dashed line, and dark coloured solid line, respectively.

Table S15: Distribution of betadispersion results. Tests for ASV, Genus and Functional groups are represented by A, G and F respectively and bolded where the result was significant at an \(\alpha\) of 0.05.
Site Soil Type Mg/ha Ash Type of Ash Arthropods (F230) Eukaryotic (18S) Fungal (ITS) Bacterial (16S)
ALN 0-10 cm mineral soil 5.0 CPLP Bottom A F G A G A F G
ALN 0-10 cm mineral soil 5.0 UNBC Bottom A F G A G A F G
ALS 0-10 cm mineral soil 5.0 CPLP Bottom A F G A G A F G
ALS 0-10 cm mineral soil 5.0 UNBC Bottom A F G A G A F G
ETM 0-10 cm mineral soil 20.0 Bottom A F G A G A F G
HLB 0-10 cm mineral soil 1.0 Fly A F G A G A F G
HLB 0-10 cm mineral soil 4.0 Bottom A F G A G A F G
HLB 0-10 cm mineral soil 4.0 Fly A F G A G A F G
ILK 0-10 cm mineral soil 1.4 Bottom A F G A G A F G A F G
PLD 0-10 cm mineral soil 1.5 Mixed A F G A G A F G
SRD 0-10 cm mineral soil 1.0 Fly A F G A G A F G A F G
HLB FH-layer forest floor 1.0 Fly A F G A G A F G A F G
HLB FH-layer forest floor 4.0 Bottom A F G A G A F G
HLB FH-layer forest floor 4.0 Fly A F G A G A F G A F G
HLB FH-layer forest floor 8.0 Bottom A F G A G A F G
HLB FH-layer forest floor 8.0 Fly A F G A G A F G A F G
ILK FH-layer forest floor 0.7 Bottom A F G A G A F G A F G
ILK FH-layer forest floor 2.8 Bottom A F G A G A F G A F G
SRD surface litter &/or moss with FH layer 10.0 Fly A F G A G A F G A F G

References

1.
Emilson, E. J. S. et al. Climate-driven shifts in sediment chemistry enhance methane production in northern lakes. Nature Communications 9, 1801 (2018).
2.
Stoeck, T. et al. Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Mol Ecol 19 Suppl 1, 21–31 (2010).
3.
Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3, 294–299 (1994).
4.
Gibson, J. F. et al. Large-Scale Biomonitoring of Remote and Threatened Ecosystems via High-Throughput Sequencing. PLOS ONE 10, e0138432 (2015).
5.
Menkis, A. et al. Occurrence and impact of the root-rot biocontrol agent Phlebiopsis gigantea on soil fungal communities in Picea abies forests of northern Europe. FEMS Microbiology Ecology 81, 438–445 (2012).
6.
White, T. et al. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. in PCR Protocols: a Guide to Methods and Applications, vol. 31 315–322 (1990).
7.
Oksanen, J. et al. vegan: Community ecology package. https://CRAN.R-project.org/package=vegan (2020).