DNA from all samples were extracted using the Qiagen DNEasy Power Soil kit. Amplification of 18S, CO1-F230 and, ITS sequences were performed at the Great Lakes Forestry Centre, Sault Ste. Marie using the primer sets in (Table S1). Triplicate PCR reactions were performed on each sample using primers using HotStarTaq Plus with illumina adaptor sequences, pooled, purified and quantified using the QiaCube fluorometric quantification. PCR reaction conditions are listed in Table S2. Metabarcoding was performed on the Illumina MiSeq platform at the Centre for Biodiversity Genomics, University of Guelph for 18S, CO1-F230 and, ITS amplicons. Amplification of amplicons and Metabarcoding were performed at Metagenombio for 16S amplicons from submitted environmental DNA.
| target | forward | reverse | |
|---|---|---|---|
| d16S | 16S v4-v5 | 5’-CCTACGGGNBGCASCAG1 | 5’-GACTACNVGGGTATCTAATCC1 |
| d18S | 18S v4 | 5’- CCAGCASCYGCGGTAATTCC2 | 5’- ACTTTCGTTCTTGATYRA2 |
| CO1F230 | CO1 - F230 | 5’- GGTCAACAAATCATAAAGATATTGG3 | 5’- CTTATRTTRTTTATICGIGGRAAIGC4 |
| ITS2 | ITS2 | 5’- GAACGCAGCRAAIIGYGA5 | 5’- TCCTCCGCTTATTGATATGC6 |
In addition to the main primer sequence, primers used for amplification of 18S, ITS, and COI sequences had an illumina p5 adapter (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3’) fused to the 5’ end of the forward primer, and another illumina p7 adapter (5’ -GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-primer-3’) fused to the 5’ end of the reverse primer.
| target | PCR conditions | |
|---|---|---|
| d18S | 18S v4 | 95°C for 5 min, 5 cycles (94°C for 45 s, 54°C for 45 s, 72°C for 45 s), 25 cycles (94°C for 45 s, 47°C for 45 s, 72°C for 45 s), 72°C for 10 min |
| CO1F230 | CO1 - F230 | 95°C for 5 min, 30 cycles (94°C for 45 s, 43°C for 45 s, 72°C for 45 s), 72°C for 10 min |
| ITS2 | ITS2 | 95°C for 5 min, 30 cycles (94°C for 45 s, 53°C for 45 s, 72°C for 45 s), 72°C for 10 min |
| Step | Total seq number (across samples) | Mean seq number (per sample) | min seq length | max seq length | mean seq length | amplicon |
|---|---|---|---|---|---|---|
| R1 | 8028118 | 46948.06 | 251.00000 | 251.0000 | 251.0000 | 16S |
| R2 | 8028118 | 46948.06 | 251.00000 | 251.0000 | 251.0000 | 16S |
| paired | 5898010 | 34491.29 | 79.57895 | 455.9942 | 411.7317 | 16S |
| Ftrimmed | 5781281 | 33808.66 | 314.18713 | 436.1988 | 392.7466 | 16S |
| Rtrimmed | 5776828 | 33782.62 | 319.52047 | 416.0526 | 372.8795 | 16S |
| R1 | 85517092 | 186718.54 | 35.55895 | 301.0000 | 295.9288 | 18S |
| R2 | 85517092 | 186718.54 | 35.53275 | 301.0000 | 296.1581 | 18S |
| paired | 76288757 | 166569.34 | 36.15502 | 486.7183 | 355.7121 | 18S |
| Ftrimmed | 19706028 | 43026.26 | 173.80568 | 466.3253 | 398.7665 | 18S |
| Rtrimmed | 19571897 | 42733.40 | 179.22926 | 448.3777 | 380.9189 | 18S |
| R1 | 85517092 | 186718.54 | 35.55895 | 301.0000 | 295.9288 | F230 |
| R2 | 85517092 | 186718.54 | 35.53275 | 301.0000 | 296.1581 | F230 |
| paired | 76288757 | 166569.34 | 36.15502 | 486.7183 | 355.7121 | F230 |
| Ftrimmed | 17889517 | 39060.08 | 184.94541 | 374.3799 | 258.3421 | F230 |
| Rtrimmed | 17856519 | 38988.03 | 181.49345 | 342.3668 | 232.4368 | F230 |
| R1 | 85517092 | 186718.54 | 35.55895 | 301.0000 | 295.9288 | ITS |
| R2 | 85517092 | 186718.54 | 35.53275 | 301.0000 | 296.1581 | ITS |
| paired | 76288757 | 166569.34 | 36.15502 | 486.7183 | 355.7121 | ITS |
| Ftrimmed | 25350300 | 55350.00 | 216.76856 | 466.3712 | 345.0956 | ITS |
| Rtrimmed | 25285054 | 55207.54 | 207.23144 | 446.3712 | 325.1651 | ITS |
| Step | number | min | max | mean | amplicon |
|---|---|---|---|---|---|
| dereplication | 2984905 | 167 | 438 | 373 | 16S |
| chimera removal | 16S/cat.denoised: 22917/75358 chimeras (30.4%) | 339 | 425 | 373 | 16S |
| dereplication | 8296788 | 150 | 458 | 381 | 18S |
| chimera removal | 18S/cat.denoised: 11306/42971 chimeras (26.3%) | 150 | 449 | 380 | 18S |
| dereplication | 3172677 | 150 | 436 | 232 | F230 |
| chimera removal | F230/cat.denoised: 2900/35935 chimeras (8.1%) | 150 | 430 | 233 | F230 |
| dereplication | 8955577 | 150 | 454 | 325 | ITS |
| chimera removal | ITS/cat.denoised: 5852/34438 chimeras (17.0%) | 152 | 450 | 320 | ITS |
The rarecurve function in vegan was used to visually examine samples for sufficient read depths (whether the number of ASVs reached a plateau) before it was decided that data analysis could proceed without rarefying7.
| Target | Number of ASV | Percent of ASV identified to Genus | Percent of ASV assigned to a functional attribute |
|---|---|---|---|
| ITS | 22083 | 49.50414 | 64.03744 |
| 16S | 27539 | 65.68140 | 48.78898 |
| F230 | 7923 | 100.00000 | 39.24602 |
| 18S | 22166 | 23.18867 | NA |
| Response variable | Test | Explanatory variables | Random variables | Data subsets |
|---|---|---|---|---|
| Enzyme activity | Mixed-effects ANOVA | ash addition, ash addition amount | site, soil type | Full datasets for NAG and PHOS activities |
| Enzyme activity | Fixed-effects ANOVA | ash addition, ash addition amount, site, soil type with interaction | None | Full datasets for PHOS and NAG activities |
| Enzyme activity | lm | applied calcium kg ha-1, applied phosphorus kg ha-1, and, applied sodium kg ha-1, Stand age, dominant tree species, precipitaion of wettest quarter, precipitation of seasonality | None | Full datasets for PHOS and NAG activities |
| Difference in enzyme activity between controls and treatment for each block | One-way Wilcoxon test | None | None | Each site, ash type and amendment rate evaluated individually for NAG and PHOS |
| One model for each diversity metric (Shannon, Inverse Simpsons, Richness) | Mixed-effects ANOVA | ash addition, ash addition amount | site, soil type | Full dataset |
| Difference between controls and treatment for each block model for each diversity metric (Shannon, Inverse Simpsons, Richness) | One-way Wilcoxon test | None | None | Each site, ash type and amendment rate evaluated individually |
| Compositional variance of each metabarcoding target and summarization level | PCA | None | None | Full dataset |
| Compositional variance of each metabarcoding target and summarization level | Partial RDA | applied calcium kg ha-1, applied phosphorus kg ha-1, and, applied sodium kg ha-1 | Site, soil type | |
| Compositional variance of each group for each metabarcoding target and summarization level | Aldex glm | applied calcium kg ha-1, applied phosphorus kg ha-1, and, applied sodium kg ha-1, Stand age, dominant tree species, precipitaion of wettest quarter, precipitation of seasonality | None | Soil type |
| Difference between control and treatment compositional variance of each group for each metabarcoding target and summarization level | Aldex pairwise analysis | None | None | Each site, ash type and amendment rate evaluated individually |
Parameter | Chisq | Df | Pr(>Chisq) |
(Intercept) | 8.8314388 | 1 | 0.003 |
Ash | 0.7055555 | 1 | 0.401 |
ash_amt | 0.5735164 | 1 | 0.449 |
Parameter | Sum Sq | Df | F values | Pr(>F) |
Site | 550,409.479 | 7 | 0.256681098 | 0.970 |
Soil_type | 1,559.923 | 1 | 0.005092244 | 0.943 |
Ash | 18,673.569 | 1 | 0.060958372 | 0.805 |
ash_amt | 224,654.887 | 1 | 0.733367897 | 0.392 |
Site:Soil_type | 5,739,893.844 | 8 | 2.342177999 | 0.019 |
Site:Ash | 272,915.415 | 7 | 0.127272932 | 0.996 |
Soil_type:Ash | 53,159.777 | 1 | 0.173535835 | 0.677 |
Site:Soil_type:Ash | 406,188.716 | 8 | 0.165746319 | 0.995 |
Residuals | 92,512,606.955 | 302 |
Parameter | Chisq | Df | Pr(>Chisq) |
(Intercept) | 7.70105436 | 1 | 0.006 |
Ash | 0.41105235 | 1 | 0.521 |
ash_amt | 0.06724982 | 1 | 0.795 |
Parameter | Sum Sq | Df | F values | Pr(>F) |
Site | 30,061.565 | 7 | 0.04401825 | 1.000 |
Soil_type | 250,582.516 | 1 | 2.56844307 | 0.110 |
Ash | 3,906.410 | 1 | 0.04004027 | 0.842 |
ash_amt | 10,525.786 | 1 | 0.10788814 | 0.743 |
Site:Soil_type | 22,232,144.065 | 8 | 28.48462718 | 0.000 |
Site:Ash | 20,997.642 | 7 | 0.03074622 | 1.000 |
Soil_type:Ash | 2,522.354 | 1 | 0.02585385 | 0.872 |
Site:Soil_type:Ash | 8,854,943.389 | 8 | 11.34527378 | 0.000 |
Residuals | 29,463,732.606 | 302 |
| Amplicon | Diversity metric | Parameter | Chisq | Degrees of Freedom | Pr(>Chisq) |
|---|---|---|---|---|---|
| ITS | Shannon | (Intercept) | 1,359.926 | 1 | 0.000 |
| ITS | Shannon | Ash | 0.015 | 1 | 0.901 |
| ITS | Shannon | ash_amt | 0.971 | 1 | 0.324 |
| ITS | InverseSimpson | (Intercept) | 57.045 | 1 | 0.000 |
| ITS | InverseSimpson | Ash | 0.191 | 1 | 0.662 |
| ITS | InverseSimpson | ash_amt | 1.473 | 1 | 0.225 |
| ITS | richness | (Intercept) | 57.045 | 1 | 0.000 |
| ITS | richness | Ash | 0.191 | 1 | 0.662 |
| ITS | richness | ash_amt | 1.473 | 1 | 0.225 |
| 16S | Shannon | (Intercept) | 1,786.247 | 1 | 0.000 |
| 16S | Shannon | Ash | 1.434 | 1 | 0.231 |
| 16S | Shannon | ash_amt | 0.499 | 1 | 0.480 |
| 16S | InverseSimpson | (Intercept) | 32.931 | 1 | 0.000 |
| 16S | InverseSimpson | Ash | 0.337 | 1 | 0.561 |
| 16S | InverseSimpson | ash_amt | 2.742 | 1 | 0.098 |
| 16S | richness | (Intercept) | 125.379 | 1 | 0.000 |
| 16S | richness | Ash | 0.035 | 1 | 0.852 |
| 16S | richness | ash_amt | 0.000 | 1 | 0.989 |
| F230 | Shannon | (Intercept) | 195.349 | 1 | 0.000 |
| F230 | Shannon | Ash | 0.891 | 1 | 0.345 |
| F230 | Shannon | ash_amt | 1.583 | 1 | 0.208 |
| F230 | InverseSimpson | (Intercept) | 15.204 | 1 | 0.000 |
| F230 | InverseSimpson | Ash | 0.101 | 1 | 0.751 |
| F230 | InverseSimpson | ash_amt | 0.010 | 1 | 0.920 |
| F230 | richness | (Intercept) | 15.204 | 1 | 0.000 |
| F230 | richness | Ash | 0.101 | 1 | 0.751 |
| F230 | richness | ash_amt | 0.010 | 1 | 0.920 |
| 18S | Shannon | (Intercept) | 1,509.821 | 1 | 0.000 |
| 18S | Shannon | Ash | 1.329 | 1 | 0.249 |
| 18S | Shannon | ash_amt | 0.617 | 1 | 0.432 |
| 18S | InverseSimpson | (Intercept) | 62.995 | 1 | 0.000 |
| 18S | InverseSimpson | Ash | 1.008 | 1 | 0.315 |
| 18S | InverseSimpson | ash_amt | 0.733 | 1 | 0.392 |
| 18S | richness | (Intercept) | 62.995 | 1 | 0.000 |
| 18S | richness | Ash | 1.008 | 1 | 0.315 |
| 18S | richness | ash_amt | 0.733 | 1 | 0.392 |
Figure S1: Scaled differences in alpha diversity metrics between treatments and controls of blocks within each site.
| Site | Soil Type | diversity_metric | Mg/ha Ash | Type of Ash | 18S | F230 | ITS | 16S |
|---|---|---|---|---|---|---|---|---|
| HLB | 0-10 cm mineral soil | InverseSimpson | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | 0-10 cm mineral soil | richness | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | 0-10 cm mineral soil | Shannon | 4.0 | Bottom | A G | A F G | A F G | NA |
| ILK | 0-10 cm mineral soil | InverseSimpson | 0.7 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | InverseSimpson | 2.8 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | InverseSimpson | 5.6 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | richness | 0.7 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | richness | 2.8 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | richness | 5.6 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | Shannon | 0.7 | Bottom | A G | A F G | A F G | A F G |
| ILK | 0-10 cm mineral soil | Shannon | 2.8 | Bottom | A G | A F G | A F G | A F G |
| HLB | FH-layer forest floor | InverseSimpson | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | FH-layer forest floor | richness | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | FH-layer forest floor | Shannon | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | FH-layer forest floor | Shannon | 8.0 | Fly | A G | A F G | A F G | A F G |
| ETM | surface litter &/or moss | InverseSimpson | 20.0 | Bottom | A G | A F G | A F G | NA |
| ETM | surface litter &/or moss | richness | 20.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | InverseSimpson | 1.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | InverseSimpson | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | InverseSimpson | 4.0 | Fly | A G | A F G | A F G | A F G |
| HLB | surface litter &/or moss | InverseSimpson | 8.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | richness | 1.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | richness | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | richness | 4.0 | Fly | A G | A F G | A F G | A F G |
| HLB | surface litter &/or moss | richness | 8.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | Shannon | 1.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | Shannon | 4.0 | Bottom | A G | A F G | A F G | NA |
| HLB | surface litter &/or moss | Shannon | 4.0 | Fly | A G | A F G | A F G | A F G |
| HLB | surface litter &/or moss | Shannon | 8.0 | Bottom | A G | A F G | A F G | NA |
Island Lake was the only site where the distances between ash-treatment and controls were larger than the differences between control replicates within plots. Though there were higher distances at Genus and Functional levels as well, only ASV is used is discussion due to the interpretation issues that are introduced from incomplete Genus and functional assignments.
Figure S2: Scaled difference in ASV community distance (Jaccard for Presence-Absence or Bray-Curtis for rarefied data) between Ash Addition plots compared to controls to distance between controls for each block. Only Island Lake is shown, as no other sites had any distances that were significantly higher than controls at \(\alpha\) = 0.05.
Figure S3: Compositional variance explained in first two PC axes for each metabarcoding dataset.
Figure S4: RDA of ITS ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions
Figure S5: RDA of 16S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions
Figure S6: RDA of F230 ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions
Figure S7: RDA of 18S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. Arrows represent ash additions
## Warning: Vectorized input to `element_text()` is not officially supported.
## Results may be unexpected or may change in future versions of ggplot2.
Figure S8: Benjamini-Hochberg corrected p-values from aldex-glms performed on ASV, Genus level and functional tables from 16S, 18S, ITS and F230 datasets. \(\alpha\) = 0.05 is shown as a lightly coloured dashed line. Parameters associated with ash quality are bolded.
Ash phosphorus addition was a significantly associated with changes in the compositonal amount of some arthropod ASVs. There were no additional significant associations of ash related paramenters to the centered log-ratio values for any targeted group after Benjamini-Hochberg correction was performed.
When assessed via pairwise comparisons using compositional t-tests, controls and treatments did not have any ASVs, genus or functional groups that were identified as significantly different (\(\alpha\) = 0.05).
## Warning: Vectorized input to `element_text()` is not officially supported.
## Results may be unexpected or may change in future versions of ggplot2.
Figure S9: Benjamini-Hochberg corrected p-values from glms on the gain or loss of a target group as compared to a control site. Glms were performed on ASV, Genus level and functional tables from 16S, 18S, ITS and F230 datasets. \(\alpha\) = 0.05 is shown as a lightly coloured dashed line. Parameters associated with ash quality are bolded.
Figure S10: Proportion of sites with changes in gain/loss of a target group significantly (B-H p <= 0.05) associated with an ash-amendment related parameter.
Upon visual inspection of the percentage of sites that had a gain or loss, patterns in ASV or genus that were found to be significantly associated to estimated total phosphorus or total calcium in the applied ash were site dependent, or showed conflicting patterns in different sites (e.g., Losses of Uroleptus in SRD and Gains at ALN, ALS sites)
We also ran some more traditional NMDS and beta-diversity analyses using the vegan package in R, which found a lack of consistent influence of ash additions on community composition. Bacterial (16S) datasets were assessed as relative abundance using Bray-Curtis distance, and all other datasets were assessed as presence/absence matrixes using Jaccard distances..
Community assemblages were visually different for some sites at the ASV level. These differences were not consistently present when datasets were summarized at genus or functional levels, which can be at least partially attributed to the loss of ASVs that could not be identified at these levels (Supplemental Results: Figures S12 - S22).
Figure S11: Ordination of ITS ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S12: Ordination of ITS functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S13: Ordination of ITS Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S14: Ordination of 16S ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S15: Ordination of 16S functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S16: Ordination of 16S Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S17: Ordination of F230 ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S18: Ordination of F230 functional groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S19: Ordination of F230 Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S20: Ordination of Eukaryote ASV groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
Figure S21: Ordination of Eukaryote Genus groups. Control sites are shown as + symbols with a solid line surrounding their distribution, while samples with ash amendment are shown as transparent circles sized to reflect the amount of ash added and surrounding with a transparent hull showing their distribution. Colour is used to represent the soil source of the sample. There was noticeable overlap between treatments and controls in most sites, for most soil layers.
| Dataset | Parameter | Degrees of Freedom | Sums of Squares | MeanSqs | F.Model | R2 | Pr(>F) |
|---|---|---|---|---|---|---|---|
| ITS_ASV | Site | 7 | 33.9741707 | 4.8534530 | 13.7167935 | 0.1668752 | 0.001 |
| ITS_ASV | Soil_type | 3 | 13.2225858 | 4.4075286 | 12.4565253 | 0.0649470 | 0.001 |
| ITS_ASV | Ash | 1 | 0.5289887 | 0.5289887 | 1.4950240 | 0.0025983 | 0.013 |
| ITS_ASV | ash_amt | 1 | 0.5319151 | 0.5319151 | 1.5032945 | 0.0026127 | 0.020 |
| ITS_ASV | Residuals | 439 | 155.3326473 | 0.3538329 | NA | 0.7629668 | NA |
| ITS_ASV | Total | 451 | 203.5903076 | NA | NA | 1.0000000 | NA |
| ITS_functional | Site | 7 | 0.2233970 | 0.0319139 | 2.0801489 | 0.0313354 | 0.001 |
| ITS_functional | Soil_type | 3 | 0.1335244 | 0.0445081 | 2.9010442 | 0.0187291 | 0.001 |
| ITS_functional | Ash | 1 | 0.0259919 | 0.0259919 | 1.6941578 | 0.0036458 | 0.140 |
| ITS_functional | ash_amt | 1 | 0.0111311 | 0.0111311 | 0.7255246 | 0.0015613 | 0.601 |
| ITS_functional | Residuals | 439 | 6.7351830 | 0.0153421 | NA | 0.9447283 | NA |
| ITS_functional | Total | 451 | 7.1292274 | NA | NA | 1.0000000 | NA |
| ITS_Genus | Site | 7 | 28.0613012 | 4.0087573 | 22.4071059 | 0.2279515 | 0.001 |
| ITS_Genus | Soil_type | 3 | 15.9488643 | 5.3162881 | 29.7156004 | 0.1295581 | 0.001 |
| ITS_Genus | Ash | 1 | 0.2728413 | 0.2728413 | 1.5250571 | 0.0022164 | 0.054 |
| ITS_Genus | ash_amt | 1 | 0.2794783 | 0.2794783 | 1.5621548 | 0.0022703 | 0.058 |
| ITS_Genus | Residuals | 439 | 78.5395699 | 0.1789056 | NA | 0.6380037 | NA |
| ITS_Genus | Total | 451 | 123.1020550 | NA | NA | 1.0000000 | NA |
| 16S_ASV | Site | 6 | 19.6980473 | 3.2830079 | 18.4602692 | 0.3334116 | 0.001 |
| 16S_ASV | Soil_type | 3 | 10.8294750 | 3.6098250 | 20.2979535 | 0.1833011 | 0.001 |
| 16S_ASV | Ash | 1 | 0.2119635 | 0.2119635 | 1.1918656 | 0.0035877 | 0.223 |
| 16S_ASV | ash_amt | 1 | 0.2417696 | 0.2417696 | 1.3594642 | 0.0040922 | 0.146 |
| 16S_ASV | Residuals | 158 | 28.0990077 | 0.1778418 | NA | 0.4756074 | NA |
| 16S_ASV | Total | 169 | 59.0802631 | NA | NA | 1.0000000 | NA |
| 16S_functional | Site | 6 | 1.2469285 | 0.2078214 | 19.1035369 | 0.2609162 | 0.001 |
| 16S_functional | Soil_type | 3 | 1.7709942 | 0.5903314 | 54.2649451 | 0.3705755 | 0.001 |
| 16S_functional | Ash | 1 | 0.0081500 | 0.0081500 | 0.7491706 | 0.0017054 | 0.490 |
| 16S_functional | ash_amt | 1 | 0.0341322 | 0.0341322 | 3.1375322 | 0.0071421 | 0.021 |
| 16S_functional | Residuals | 158 | 1.7188327 | 0.0108787 | NA | 0.3596608 | NA |
| 16S_functional | Total | 169 | 4.7790375 | NA | NA | 1.0000000 | NA |
| 16S_Genus | Site | 6 | 10.4732088 | 1.7455348 | 30.2063369 | 0.3863799 | 0.001 |
| 16S_Genus | Soil_type | 3 | 7.3481268 | 2.4493756 | 42.3862441 | 0.2710887 | 0.001 |
| 16S_Genus | Ash | 1 | 0.0751724 | 0.0751724 | 1.3008516 | 0.0027733 | 0.221 |
| 16S_Genus | ash_amt | 1 | 0.0791306 | 0.0791306 | 1.3693490 | 0.0029193 | 0.186 |
| 16S_Genus | Residuals | 158 | 9.1303523 | 0.0577870 | NA | 0.3368389 | NA |
| 16S_Genus | Total | 169 | 27.1059910 | NA | NA | 1.0000000 | NA |
| F230_ASV | Site | 7 | 20.7381843 | 2.9625978 | 7.1325441 | 0.1090650 | 0.001 |
| F230_ASV | Soil_type | 3 | 6.7971089 | 2.2657030 | 5.4547487 | 0.0357469 | 0.001 |
| F230_ASV | Ash | 1 | 0.5189532 | 0.5189532 | 1.2493955 | 0.0027292 | 0.028 |
| F230_ASV | ash_amt | 1 | 0.5146315 | 0.5146315 | 1.2389911 | 0.0027065 | 0.013 |
| F230_ASV | Residuals | 389 | 161.5763621 | 0.4153634 | NA | 0.8497523 | NA |
| F230_ASV | Total | 401 | 190.1452401 | NA | NA | 1.0000000 | NA |
| F230_functional | Site | 7 | 6.4025259 | 0.9146466 | 7.0844409 | 0.0981975 | 0.001 |
| F230_functional | Soil_type | 3 | 8.3954727 | 2.7984909 | 21.6758520 | 0.1287640 | 0.001 |
| F230_functional | Ash | 1 | 0.0714515 | 0.0714515 | 0.5534309 | 0.0010959 | 0.708 |
| F230_functional | ash_amt | 1 | 0.1086533 | 0.1086533 | 0.8415795 | 0.0016664 | 0.482 |
| F230_functional | Residuals | 389 | 50.2223839 | 0.1291064 | NA | 0.7702762 | NA |
| F230_functional | Total | 401 | 65.2004873 | NA | NA | 1.0000000 | NA |
| F230_Genus | Site | 7 | 20.3349198 | 2.9049885 | 9.1685638 | 0.1321508 | 0.001 |
| F230_Genus | Soil_type | 3 | 9.5102304 | 3.1700768 | 10.0052207 | 0.0618043 | 0.001 |
| F230_Genus | Ash | 1 | 0.3940371 | 0.3940371 | 1.2436380 | 0.0025607 | 0.104 |
| F230_Genus | ash_amt | 1 | 0.3857501 | 0.3857501 | 1.2174830 | 0.0025069 | 0.121 |
| F230_Genus | Residuals | 389 | 123.2516414 | 0.3168423 | NA | 0.8009773 | NA |
| F230_Genus | Total | 401 | 153.8765787 | NA | NA | 1.0000000 | NA |
| 18S_ASV | Site | 7 | 23.1246266 | 3.3035181 | 9.2482505 | 0.1178996 | 0.001 |
| 18S_ASV | Soil_type | 3 | 15.5969925 | 5.1989975 | 14.5546747 | 0.0795204 | 0.001 |
| 18S_ASV | Ash | 1 | 0.4903257 | 0.4903257 | 1.3726743 | 0.0024999 | 0.025 |
| 18S_ASV | ash_amt | 1 | 0.4706715 | 0.4706715 | 1.3176523 | 0.0023997 | 0.035 |
| 18S_ASV | Residuals | 438 | 156.4556366 | 0.3572046 | NA | 0.7976804 | NA |
| 18S_ASV | Total | 450 | 196.1382528 | NA | NA | 1.0000000 | NA |
| 18S_Genus | Site | 7 | 14.1249361 | 2.0178480 | 13.9566615 | 0.1582337 | 0.001 |
| 18S_Genus | Soil_type | 3 | 11.4207355 | 3.8069118 | 26.3309125 | 0.1279401 | 0.001 |
| 18S_Genus | Ash | 1 | 0.2034405 | 0.2034405 | 1.4071177 | 0.0022790 | 0.076 |
| 18S_Genus | ash_amt | 1 | 0.1913415 | 0.1913415 | 1.3234342 | 0.0021435 | 0.112 |
| 18S_Genus | Residuals | 438 | 63.3258487 | 0.1445796 | NA | 0.7094037 | NA |
| 18S_Genus | Total | 450 | 89.2663024 | NA | NA | 1.0000000 | NA |
Figure S22: Significance of pairwise PERMANOVA test results for each soil layer, site and treatment combination as compared to controls. Values lower than 0.05 were spread amongst different taxonomic levels and targets. Lower p-values indicated that there was a low probability of the community from ash treatment being the same as controls from the same site. Colour and shape are used to differentiate the targeted sequence and grouping level used for each test.
PERMANOVA tests of each metabarcode summarized at ASV, Genus and functional characteristics showed significant (p <0.05) influence of ash amendment or ash amount on community composition for ITS, F230 and 18S datasets. The majority of the variance was explained by site and soil horizon, and ash amendment explained a small proportion of the variance, with R2 values less than 0.003. Pairwise assessment of community distributions from block treatment-control pairings showed a small proportion of treatments that resulted in a shift from controls significant at \(\alpha\) = 0.05, only the ILK F230 ASV dataset FH layer was found to be significantly different between 2.8 t ha-1 wood ash amended soils and controls after using a Bonferroni-corrected alpha to account for the number of tests performed (Figure S22).
| Site | Soil Type | Mg/ha Ash | Type of Ash | Arthropods (F230) | Eukaryotic (18S) | Fungal (ITS) | Bacterial (16S) |
|---|---|---|---|---|---|---|---|
| HLB | 0-10 cm mineral soil | 4.0 | Fly | A F G | A G | A F G | |
| HLB | 0-10 cm mineral soil | 8.0 | Bottom | A F G | A G | A F G | |
| ILK | 0-10 cm mineral soil | 1.4 | Bottom | A F G | A G | A F G | A F G |
| ILK | 0-10 cm mineral soil | 2.8 | Bottom | A F G | A G | A F G | A F G |
| SRD | 0-10 cm mineral soil | 10.0 | Fly | A F G | A G | A F G | A F G |
| HLB | FH-layer forest floor | 1.0 | Fly | A F G | A G | A F G | A F G |
| HLB | FH-layer forest floor | 8.0 | Bottom | A F G | A G | A F G | |
| ILK | FH-layer forest floor | 0.7 | Bottom | A F G | A G | A F G | A F G |
| ILK | FH-layer forest floor | 1.4 | Bottom | A F G | A G | A F G | A F G |
| ILK | FH-layer forest floor | 2.8 | Bottom | A F G | A G | A F G | A F G |
| ILK | FH-layer forest floor | 5.6 | Bottom | A F G | A G | A F G | A F G |
| PLD | surface litter &/or moss with FH layer | 1.5 | Mixed | A F G | A G | A F G | A F G |
| SRD | surface litter &/or moss with FH layer | 1.0 | Fly | A F G | A G | A F G | A F G |
Potential differences detected in some sites occurred in both clearcut (ILK, PLD, SRD) and selection cut systems (HLB). Most of these differences were from the Island Lake site, for 18S and ITS data, indicating a fungal response. Significant (at \(\alpha\) = 0.05) PERMANOVA results did not coincide with significant differences in betadispersion, showing that these differences are likely due to a shift in average community composition, rather than a differences in community structure variance (Supplemental Results: Table S10, S11). The differences in betadispersion were mainly from the ASV level analyses of F230 (arthropod) datasets, and corresponded to NMDS analysis, suggesting that there is generally higher dispersion in the controls compared to individual treatments. The solid polygons representing treatment dispersals were generally smaller than the area encapsulated by the solid line (Supplementary Results: Figure S19, Figure S20). Only the ILK sites had shifts in community distance due to treatment that were significantly greater than distances between controls within blocks. However, these differences were comparable to the distances from between-block comparisons (Supplemental Results: Figure S2).
Figure S23: Significance of pairwise betadispersion testing from metabarcoding subsets summarized at functional, genus and ASV levels. Significance at an \(\alpha\) of 0.05 and the Bonferonni corrected \(\alpha\) for each subset are shown on the graph as a light coloured dashed line, and dark coloured solid line, respectively.
| Site | Soil Type | Mg/ha Ash | Type of Ash | Arthropods (F230) | Eukaryotic (18S) | Fungal (ITS) | Bacterial (16S) |
|---|---|---|---|---|---|---|---|
| ALN | 0-10 cm mineral soil | 5.0 | CPLP Bottom | A F G | A G | A F G | |
| ALN | 0-10 cm mineral soil | 5.0 | UNBC Bottom | A F G | A G | A F G | |
| ALS | 0-10 cm mineral soil | 5.0 | CPLP Bottom | A F G | A G | A F G | |
| ALS | 0-10 cm mineral soil | 5.0 | UNBC Bottom | A F G | A G | A F G | |
| ETM | 0-10 cm mineral soil | 20.0 | Bottom | A F G | A G | A F G | |
| HLB | 0-10 cm mineral soil | 1.0 | Fly | A F G | A G | A F G | |
| HLB | 0-10 cm mineral soil | 4.0 | Bottom | A F G | A G | A F G | |
| HLB | 0-10 cm mineral soil | 4.0 | Fly | A F G | A G | A F G | |
| ILK | 0-10 cm mineral soil | 1.4 | Bottom | A F G | A G | A F G | A F G |
| PLD | 0-10 cm mineral soil | 1.5 | Mixed | A F G | A G | A F G | |
| SRD | 0-10 cm mineral soil | 1.0 | Fly | A F G | A G | A F G | A F G |
| HLB | FH-layer forest floor | 1.0 | Fly | A F G | A G | A F G | A F G |
| HLB | FH-layer forest floor | 4.0 | Bottom | A F G | A G | A F G | |
| HLB | FH-layer forest floor | 4.0 | Fly | A F G | A G | A F G | A F G |
| HLB | FH-layer forest floor | 8.0 | Bottom | A F G | A G | A F G | |
| HLB | FH-layer forest floor | 8.0 | Fly | A F G | A G | A F G | A F G |
| ILK | FH-layer forest floor | 0.7 | Bottom | A F G | A G | A F G | A F G |
| ILK | FH-layer forest floor | 2.8 | Bottom | A F G | A G | A F G | A F G |
| SRD | surface litter &/or moss with FH layer | 10.0 | Fly | A F G | A G | A F G | A F G |